ISSN 2500-2236
DOI-prefix: 10.18527/2500-2236
ИССЛЕДОВАТЕЛЬСКАЯ СТАТЬЯ

Адаптация метода количественной ПЦР для выявления представителей микобиоты зерновых культур

Аннотация


Проведена сравнительная оценка содержания ДНК грибов и микотоксинов в зерне 31 сорта пшеницы, овса и ячменя. Метод количественной ПЦР был адаптирован для выявления ДНК грибов, часто встречающихся в микобиоте зерновых культур: Alternaria spp., Bipolaris sorokiniana (B. sorokiniana), Fusarium graminearum (F. graminearum), F. culmorum и F. sporotrichioides. Количественное выявление в зерне ДНК гриба B. sorokiniana проведено впервые.

ДНК грибов Alternaria выявлена во всех образцах в диапазоне от 184×10-4 до 11160×10-4 пг/нг общей ДНК, но в зерне овса, по сравнению с зерном ячменя и пшеницы, ее количества были больше в 5 и 9 раз соответственно. ДНК B. sorokiniana выявлена во всех образцах зерна ячменя и овса, а также в 56% образцов пшеницы. В зерне ячменя содержание ДНК B. sorokiniana в среднем было существенно выше (402×10-4 пг/нг), чем в зерне овса (51×10-4 пг/нг) и пшеницы (10×10-4 пг/нг). Присутствие ДНК гриба F. graminearum установлено в зерне всех анализированных образцов в диапазоне от 14×10-4 до 1110×10-4 пг/нг, ДНК F. culmorum выявлена в 70% образцов овса и в 100% образцов ячменя и пшеницы в количестве от 8×10-4 до 90×10-4 пг/нг. Микотоксин дезоксиниваленол (ДОН), продуцируемый грибами F. graminearum и F. culmorum, выявлен в зерне всех образцов в диапазоне от 77 до 4133 мкг/кг. ДНК F. sporotrichioides, продуцирующего Т-2 токсин, обнаружена в 70% образцов овса и 50% образцов ячменя в количестве от 5×10-4 до 47×10-4 пг/нг и не выявлена в зерне пшеницы. Количество T-2 токсина, обнаруженного в 45% образцов, не превышало 89 мкг/кг.

Установлена достоверная положительная связь между количествами ДНК F. graminearum и ДОН в зерне. Коэффициент корреляции Пирсона (r) составил 0.49 (p <0.05). Также выявлена положительная связь (r = 0.72, p <0.01) между количествами ДНК Alternaria spp. и F. sporotrichioides, что предполагает сходство условий для развития этих грибов на зерновом субстрате.

Abstract


The content of fungal DNA and mycotoxins in cereal crops (31 varieties of wheat, oats, and barley) was quantitatively determined and used for comparative characterization of grains. The quantitative PCR has been adapted for the analysis of the target DNA of Alternaria spp., Bipolaris sorokiniana (B. sorokiniana), Fusarium graminearum (F. graminearum), F. culmorum, and F. sporotrichioides fungi, which are often present in mycobiota of small grain cereals. The content of DNA of aggressive pathogen B. sorokiniana was determined using quantitative PCR for the first time.

The DNA of Alternaria fungi was found abundantly in all grain samples, but its content in the oat was significantly higher compared to barley and wheat (5 and 9 times higher, respectively). In barley grain, the content of B. sorokiniana DNA was on average significantly higher than in the grains of oats and wheat. The presence of F. graminearum DNA was established in all the analyzed grain samples while the F. culmorum DNA was found in 70% of the oat’s samples and in all samples of barley and wheat. Mycotoxin deoxynivalenol (DON) produced by these fungi was detected in all analyzed cereal grains in a range from 77 to 4133 μg/kg. The DNA of F. sporotrichioides was detected in 70% of oats and 50% of barley samples but was not found in wheat. The T-2 toxin produced by this fungus was detected in 45% of all samples within the range from 2 to 89 μg/kg.

The statistically significant positive correlation with the Pearson correlation coefficient (r) equal to 0.49 (p<0.05) was observed between the amount of F. graminearum DNA and DON in the grain samples. Another significant positive correlation (r = 0.72, p<0.01) was found between DNA contents of Alternaria fungi and F. sporotrichioides in the grain samples. This leads to the suggestion that conditions for growth of these fungi in grain substrates are similar.

Введение


Процент зараженных зерновок – стандартный показатель, используемый для характеристики микробиологической чистоты зерна. Однако, в зависимости от ряда факторов (культура, устойчивость сорта, время заражения, условия окружающей среды), гриб способен проникать в ткани зерновки на различную глубину и локализоваться в цветковой пленке, в алейроновом слое или полностью заселять эндосперм и зародыш. Поэтому процент зараженного зерна, установленный в результате микологического анализа, как правило, слабо связан со всхожестью зерна и содержанием микотоксинов, продуцируемых грибами [1, 2]. Эта проблема особенно характерна для пленчатых культур (овса и ячменя), у которых цветковая пленка зачастую обильно колонизирована разными видами грибов при низкой зараженности самого зерна. Кроме того, анализ зараженности зерна микробиологическим методом затруднен его длительностью (7–14 суток) и субъективностью получаемых результатов (точность идентификации грибов зависит от опыта исследователя).

Точный количественный анализ присутствия патогенов в зерне и выявление закономерностей заражения ими растений в разных условиях среды (годовые колебания погодных условий, изменения технологии возделывания культур) являются актуальными задачами настоящего времени. К числу современных методов количественного анализа содержания грибов в зерне относится количественная полимеразная цепная реакция (кПЦР), или ПЦР в реальном времени. При помощи этого метода, основанного на использовании фрагментов ДНК грибов в качестве молекулярных маркеров, можно оценить количество ДНК-мишени патогена или группы сходных патогенов [1, 3-6].

Методы молекулярной биологии позволяют выявить присутствие грибов в образцах растительной ткани, даже если патоген утратил свою жизнеспособность и не был обнаружен традиционным микологическим методом. Количество ДНК гриба, выявленной в образце зерна, зависит от биомассы гриба и является наиболее корректным показателем присутствия патогена в зерне, позволяющим с высокой точностью прогнозировать наличие микотоксинов. Кроме того, метод ПЦР имеет такие неоспоримые преимущества перед микробиологическими методами, как объективность количественной оценки, высокая чувствительность и скорость анализа, а также возможность одновременного анализа большого количества образцов.

Целью исследования являлась адаптация метода количественной ПЦР для оценки содержания ДНК грибов Alternaria Nees, Bipolaris Shoemaker и Fusarium Link, относящихся к наиболее широко распространенным представителям микобиоты зерна.

Материалы и методы


Образцы зерновых культур

В 2016 г. в поле на территории Волосовского госсортоучастка (Ленинградская область) в конкурсных испытаниях были посеяны зерновые культуры, включающие 10 сортов овса: Аватар (Россия), Боррус (Германия), Всадник (Россия), Залп (Россия), КВС Контендер (Германия), Медведь (Россия), Озон (Германия), Привет (Россия), Стиплер (Россия) и Яков (Россия); 9 сортов пшеницы: Велламо (Россия), Каликсо (Франция), Ленинградская 6 (Россия), Ленинградская 12 (Россия), Ленинградская 97 (Россия), Ликамеро (Франция), Марбл (Канада), Сударыня (Россия) и Тризо (Германия); 12 сортов ячменя: Бенте (Германия), Деспина (Германия), Инари (Финляндия), Криничный (Беларусь), Ленинградский (Россия), Московский 86 (Россия), Норд 132523 (Германия), Олимпик (Франция), Саломе (Германия), Суздалец (Россия), Фэст (Беларусь) и Черио (Германия). Семена высевали без предварительного протравливания, культуры возделывали по принятой на госсортоучастках технологии.

Зерно нового урожая (по 10 г среднего образца каждого сорта) гомогенизировали в стерильных размольных стаканах на мельнице Tube Mill Control (IKA, Германия) в течение 30 с. Скорость размола зерна составляла 20000 об/мин. Размолотую муку хранили при –20℃ до последующей экстракции ДНК (навеска 200 мг) и микотоксинов (навеска 1 г).

Микологический анализ зерна

Для того чтобы выявить основные группы патогенов в микобиоте зерна и целенаправленно определить их содержание с помощью кПЦР, провели микологический анализ зерна шести сортов (по два каждой культуры) на питательной картофельно-сахарозной агаризованной среде (КСА). Из каждого среднего образца отбирали 100-200 зерен, которые поверхностно стерилизовали 5% раствором гипохлорита натрия в течение 1-3 мин. Затем зерна отмывали стерильной водой и раскладывали в чашки Петри на КСА. В питательную среду предварительно вносили 1 мл/л смеси антибиотиков (HyClone™, GE Healthcare Life Sciences, Австрия) для подавления роста бактерий и 0.4 мкл/л раствора Triton X 100 (Panreac, Испания) для снижения линейного роста мицелиальных грибов [2].

Через 7 суток инкубирования чашек Петри в термостате (в темноте, при 24℃) проводили учет численности и разнообразия грибов. Таксономическую принадлежность выросших микромицетов определяли по сумме макро- и микроморфологических признаков с использованием определителя [7]. Зараженность зерна определенным таксоном рассчитывали как отношение числа зерен, из которых был выделен данный таксон, к общему числу анализируемых зерен, выраженное в процентах.

Выделение ДНК и кПЦР

Выделение ДНК из зерновой муки проводили с помощью набора Genomic DNA Purification Kit (Thermo Fisher Scientific, Литва) согласно адаптированному протоколу. С помощью этого же набора выделяли ДНК из мицелия типовых штаммов грибов Alternaria tenuissima (A. tenuissima) (Nees et T. Nees: Fr.) Wiltshire (MFP556081), B. sorokiniana Shoemaker (MFG59013), F. graminearum Schwabe (MFG58775), F. culmorum (Wm.G. Sm.) Sacc. (MFG102100), F. sporotrichioides Sherb. (MGF163303), выращенных на КСА. Все типовые штаммы грибов хранятся в коллекции лаборатории микологии и фитопатологии ФГБНУ ВИЗР.

Концентрации ДНК, полученной из муки и штаммов, оценивали, используя флуориметр Qubit 2.0 с набором реагентов Quant–iT dsDNA HS Assay Kit (Thermo Fisher Scientific, США). Концентрацию ДНК, выделенной из муки, выравнивали до 2-50 нг/мкл. Исходную ДНК типовых штаммов грибов разбавляли до концентрации 10 нг/мкл и использовали для построения калибровочной кривой в десятикратных последовательных разведениях.

Содержание ДНК грибов Alternaria и F. graminearum оценивали методом кПЦР с зондами TaqMan. Реакцию проводили в объеме 20 мкл, содержащем 10 мкл 2×TaqM мастер-микс (АлкорБио, Россия), 300 нМ каждого праймера, 100 нМ флуоресцентной пробы (Евроген, Россия) и 2 мкл раствора ДНК. Содержание ДНК F. culmorum, F. sporotrichioides и B. sorokiniana определяли с помощью кПЦР с красителем SYBR Green. Реакцию проводили в объеме 20 мкл, содержащем 4 мкл 5×qPCRmix-HS SYBR мастер-микса, 500 нМ каждого праймера (все реактивы – Евроген, Россия) и 2 мкл раствора ДНК. Последовательности праймеров и протоколы амплификации представлены в Таб­лице 1. Реакции проводили на термоциклере CFX96 Real-Time System (BioRad, США), обработку первичных данных – с помощью программного обеспечения Bio-Rad CFX Manager 1.6.

Целевой объект

Название праймеров и проб

Последовательность праймеров и проб, 5’– 3’

Протокол амплификации

Литературный источник

F. graminearum

TMFg12f

CTCCGGATATGTTGCGTCAA

95℃– 15 мин; [95℃ – 15 с; 60℃ – 60 с]×40

[1]

TMFg12r

CGAAGCATATCCAGATCATCCA

TMFg12p

FAM-GAGAATGTCTTGAGGCAATGCGAACTTT-BHQ1

F. culmorum

FculC561f

CACCGTCATTGGTATGTTGTCACT

50℃ – 2 мин, 95℃ – 10 c, []×40

[3]

FculC614r

CGGGAGCGTCTGATAGTCG

F. sporotrichioides

PFusf

CCGCGCCCCGTAAAACG

95℃ – 3 мин, []×40

[8]

PSporR

ACTGTGTTTGCACACAGATC

Alternaria spp.

DirITSAlt

TGTCTTTTGCGTACTTCTTGTTTCCT

95℃ – 3 мин; [95℃ – 10 с; 60℃ – 60 с; 72℃ – 3 с]×40

[5, 9]

InvITSAlt

CGACTTGTGCTGCGCTC

AltTM

FAM-AACACCAAGCAAAGCTTGAGGGTACAAAT-TAMRA

B. sorokiniana

COSA_F

TCAAGCTGACCAAATCACCTTC

95℃ – 3 мин; [95℃ – 10 с; 68℃ – 20 с; 72℃ – 45 с]×40

[10], с модификациями

COSA_R

CTTCTCACCAGCATCTGAATATATGA

Таблица 1. Последовательности праймеров и проб, протоколы амплификации кПЦР, использованные в исследовании

Количество ДНК грибов выражали в виде доли от общей ДНК, выделенной из зерновой муки (пг/нг общей ДНК). Нижний достоверный предел выявления содержания ДНК грибов в пробе общей ДНК был установлен на уровне 5×10-4 пг/нг общей ДНК.

Иммуноферментный анализ (ИФА)

Иммуноферментным методом анализировали содержание двух микотоксинов – дезоксиниваленола (ДОН), образуемого F. graminearum и F. culmorum, и Т-2 токсина, образуемого F. sporotrichioides. Микотоксины экстрагировали из 1 г муки, добавляя 5 мл водного раствора ацетонитрила (84:16, v/v), в условиях постоянного перемешивания на шейкере S-3M (ELMI, Латвия) при 300 об/мин в течение 14-16 часов. Анализ выполняли с помощью двух диагностических тест-систем для непрямого твердофазного конкурентного ИФА: «Дезоксиниваленол-ИФА» и «Т-2 токсин-ИФА» (ВНИИВСГЭ, Россия) – с нижним пределом чувствительности 20 и 4 мкг/кг соответственно. Для построения калибровочных кривых использовали стандарты микотоксинов в ацетонитриле с концентрацией 1 мкг/мл (ВНИИВСГЭ, Россия). ИФА выполняли на наборных полистироловых планшетах (Биомедикал, Россия) с последующим измерением оптической плотности растворов при длине волны 492 нм на фотометре LEDETECT 96 (Biomed, Австрия).

Статистический анализ

Все лабораторные анализы выполняли как минимум двукратно. Полученные результаты обрабатывали с помощью статистических программ Microsoft Excel 2010 и STATISTICA 10.0. Связь между количественными признаками оценивали с использованием линейного коэффициента корреляции Пирсона (r). Коэффициент вариации (V, %) рассчитывали как процентное отношение среднеквадратического отклонения к среднему арифметическому ряда показателей.

Результаты


Микологический анализ показал значительное присутствие грибов Alternaria и Fusarium во всех образцах зерна (Таблица 2). В отличие от пшеницы, в образцах зерна овса и ячменя выявлен B. sorokiniana. Кроме этих представителей микобиоты, из зерна были выделены изоляты других грибов: Microdochium Syd. & P.Syd., Aureobasidium Viala & G.Boyer, Epicoccum Link и Trichothecium roseum (Pers) Link.

Культура

Сорт

Зараженность зерна грибами, %

Fusarium

Alternaria

B. sorokiniana

Epicoccum

Microdochium

Aureobasidium

T. roseum

Овес

Borrus

66

42

4

4

0

3

0

Всадник

56

31

9

2

0

2

0

Ячмень

Инари

84

18

10

0

0

7

0

Криничный

89

24

9

0

0

6

0

Пшеница

Сударыня

56

26

0

2

9

0

2

Тризо

61

18

0

1

4

0

0

Таблица 2. Зараженность образцов зерна, выявленная микологическим методом

ДНК грибов Alternaria выявлена во всех анализированных образцах зерна. В среднем, зерно различных сортов овса содержало в 5 и 9 раз больше ДНК грибов Alternaria по сравнению с исследованными образцами сортов ячменя и пшеницы соответственно (Рис. 1). Наименьшее количество ДНК Alternaria определено в зерне пшеницы сорта Тризо (184×10-4 пг/нг), а максимальное количество Alternaria (11160×10-4 пг/нг общей ДНК) – в зерне овса сорта Озон.

Впервые проведена оценка зараженности зерна российского происхождения грибом B. sorokiniana с помощью метода кПЦР (Рис. 2). Молекулярные праймеры, первоначально разработанные для качественной детекции ДНК этого патогена в зерне [10], успешно адаптированы нами для количественного анализа. ДНК B. sorokiniana выявлена в 100% образцов зерна ячменя и овса и только в 56% образцов пшеницы. В среднем, в образцах ячменя количество ДНК B. sorokiniana было существенно выше по сравнению с зерном овса и пшеницы. Максимум ДНК B. sorokiniana (648×10-4 пг/нг общей ДНК) выявлен в зерне ячменя сорта Олимпик.

Оценка содержания ДНК F. graminearum в зерне показала присутствие этого патогена во всех анализированных образцах (Таблица 3). Максимальное количество ДНК F. graminearum выявлено в зерне ячменя сорта Фэст (1110×10-4 пг/нг). ДНК F. culmorum выявлена в 70% образцов овса и 100% образцов ячменя и пшеницы. Максимальное количество ДНК этого гриба – 90×10-4 пг/нг – обнаружено в зерне овса сорта Медведь. ДНК F. sporotrichioides, продуцирующего Т-2 токсин, не выявлена ни в одном из образцов зерна пшеницы, но обнаружена в 70% образцов овса и 50% – ячменя. В среднем, ДНК F. sporotrichioides выявлена в более низких количествах (до 47×10-4 пг/нг) по сравнению с другими видами грибов.

Показатель

Количества ДНК грибов ×10-4, пг/нг общей ДНК, и микотоксинов, мкг/кг

овес

ячмень

пшеница

n+а, %

среднее (диапазон)

n+, %

среднее (диапазон)

n+, %

среднее (диапазон)

F. graminearum

100

76 (14-261)

100

170 (22-1110)

100

203 (55-561)

F. culmorum

70

21 (8-90)

100

17 (9-43)

100

22 (11-39)

F. sporotrichioides

70

17 (5-47)

50

6 (6-26)

0

0

ДОН

100

357 (9-666)

100

499 (77-2154)

100

2318 (455-4471)

Т-2 токсин

40

7 (5-12)

67

22 (3-89)

33

18 (2-38)

а n+ – количество образцов, в которых выявлен анализируемый показатель.

Таблица 3. Содержание ДНК грибов Fusarium и микотоксинов в образцах зерновых культур

Микотоксин ДОН выявлен в 100% анализированных образцов зерна, с диапазоном количества от 77 до 4133 мкг/кг, в то время как T-2 токсин обнаружен только в 45% образцов в более низких количествах – от 2 до 89 мкг/кг (Таблица 3).

Сравнительный анализ загрязнения зерна трех культур микотоксинами показал, что в образцах пшеницы количество ДОН было достоверно выше, чем в образцах овса и ячменя. Содержание Т-2 токсина в образцах ячменя было выше по сравнению с образцами овса и пшеницы в 7 и 3 раза соответственно.

Минимальное количество ДОН выявлено в зерне ячменя сорта Ленинградский, а максимальное – в зерне пшеницы сорта Каликсо. При установленной высокой зараженности зерна продуцентами F. graminearum и F. culmorum ожидаемо выявлены образцы зерна, в которых среднее количество ДОН превышало предельно допустимую концентрацию (ПДК) этого микотоксина в зерне и зернопродуктах (700-1000 мкг/кг) [11]. Число образцов, загрязненных ДОН в количествах выше ПДК, составило 32% (сорта ячменя Московский 86, Фэст и все сорта пшеницы за исключением сорта Ленинградская 6). Те образцы зерна, в которых был выявлен Т-2 токсин, содержали его в количествах ниже установленной ПДК (100 мкг/кг) [11]. Максимальное количество этого микотоксина (89 мкг/кг) выявлено в зерне ячменя сорта Черио.

Корреляционный анализ экспериментальных данных выявил достоверную положительную связь (r=0.49, p <0.05) между количествами ДНК F. graminearum и ДОН в зерне. В то же время связи между количествами ДНК F. culmorum – другого продуцента ДОН – и этого микотоксина не установлено. Данный факт был также отмечен другими исследователями [12], показавшими, что F. culmorum продуцирует значительно меньшие количества ДОН по сравнению с F. graminearum [13].

Заслуживает внимания выявление высокой положительной связи (r=0.72, p <0.01) между количествами ДНК грибов Alternaria и F. sporotrichioides, что предполагает сходство условий для их развития на общем субстрате. Ранее мы уже отмечали, что при колонизации зерна овса между агрессивными видами Fusarium и относительно слабыми патогенами Alternaria возникают симбиотические взаимоотношения [14].

Обсуждение


Грибы рода Alternaria встречаются в разнообразных растениях, но до настоящего времени их вредоносность является спорной. В наших исследованиях показана разница между зерновыми культурами по количеству биомассы Alternaria spp., однако внутри одного вида растения рассчитанный коэффициент вариации V содержания ДНК грибов был невысоким и сходным по величине (41–68%), что говорит об отсутствии дифференцированного взаимодействия в системе сорта и грибов рода Alternaria.

Гриб B. sorokiniana является вредоносным патогеном зерновых культур, в особенности ячменя. B. sorokiniana вызывает снижение всхожести зерна, пятнистость листьев, корневую гниль. Микологический анализ выявил зараженность этим патогеном только зерна овса и ячменя, но не обнаружил его в зерне анализированных сортов пшеницы. Полученные методом кПЦР результаты подтверждают значительное содержание ДНК этого гриба в зерне ячменя, превышающее его содержание в зерне овса в 8 раз, а пшеницы – в 40 раз.

Мы провели анализ содержания ДНК грибов F. graminearum, F. culmorum и F. sporotrichioides, а также продуцируемых ими опасных микотоксинов. В образцах зерна количества ДНК F. sporotrichioides и, как следствие, образуемого им Т-2 токсина были низкими. Значительное загрязнение зерна ДОН, особенно в случае пшеницы, связано с высоким содержанием ДНК F. graminearum. Достоверная связь между содержанием ДНК гриба и микотоксина, продуцентом которого он является, позволяет использовать метод кПЦР для быстрой характеристики селекционного материала при создании устойчивых сортов, оценки эффективности фунгицидов и контроля качества получаемого урожая зерна или продукции на его основе. Количественная ПЦР является также удобным и объективным методом анализа в экспериментах, выявляющих взаимоотношения между растениями и представителями микобиоты. Быстрое обнаружение и оценка содержания патогенов позволяют объективно устанавливать в динамике воздействие различных условий, а также определять эффективность мероприятий, направленных на снижение их вредоносности.

ЗАКЛЮЧЕНИЕ

Высокая чувствительность метода количественного выявления ДНК грибов и относительная быстрота получения информации позволяют объективно определять содержание фитопатогенов в анализируемом материале. Адаптированный метод кПЦР позволил количественно оценить присутствие в урожае зерна пшеницы, овса и ячменя патогенных видов грибов F. graminearum, F. culmorum, F. sporotrichioides, B. sorokiniana, а также широко распространенных представителей рода Alternaria. Для всех анализированных образцов зерна показано высокое содержание грибов Alternaria, экологическая значимость которых до сих пор точно не известна. Гриб B. sorokiniana выявлен в зерне всех культур, однако отмечено значительное преобладание содержания ДНК этого патогена в зерне ячменя. Установленное высокое содержание ДНК F. graminearum в зерне всех культур является причиной значительного загрязнения зерна микотоксином ДОН.

Благодарности


Работа выполнена при финансовой поддержке РНФ (проект № 14-26-00067). Авторы выражают благодарность сотрудникам Волосовского госсортоучастка (Ленинградская область) за предоставленные образцы зерна.

Конфликт интересов


Авторы не преследуют коммерческих или финансовых интересов.

Цитирование


Орина АС, Гаврилова ОП, Гагкаева ТЮ. Адаптация метода количественной ПЦР для выявления представителей микобиоты зерновых культур. MIR J, 2018; 5(1), 71-77, doi: 10.18527/2500-2236-2018-5-1-71-77.


© 2018 Орина и др. Эта статья публикуется в свободном доступе в соответствии с лицензией Creative Commons AttributionNonCommercial-ShareAlike 4.0 International Public License (CC BY-NC-SA), которая позволяет неограниченное использование, распространение и воспроизведение на любых носителях при условии, что указываются автор и источник публикации, а материал не используется в коммерческих целях.

Литература


1.   Yli-Mattila T, Paavanen-Huhtala S, Jestoi M, Parikka P, Hietaniemi V, Gagkaeva T, Sarlin T, Haikara A, Laaksonen S, Rizzo A. Real-time PCR detection and quantification of Fusarium poae, F. graminearum, F. sporotrichioides and F. langsethiae in cereal grains in Finland and Russia. Arch Phytopathol Plant Protect, 2008; 41(4). 243–60. doi: 10.1080/03235400600680659.

2.   Шипилова НП, Гаврилова ОП, Гагкаева ТЮ. Влияние зараженности грибами рода Fusarium на качественные характеристики зерна озимой пшеницы. Вестник защиты растений, 2014; (4), 27–31.

3.   Nicholson P, Simpson DR, Weston G, Rezanoor HN, Lees AK, Parry DW, Joyce D. Detection and quantification of Fusarium culmorum and Fusarium graminearum in cereals using PCR assays. Physiol Mol Plant Pathol, 1998; 53, 17–37. doi: 10.1006/pmpp.1998.0170.

4.   Stakheev A, Ryazantsev DYu, Gagkaeva TYu, Zavrieva SK. PCR detection of Fusarium fungi with similar profiles of the produced mycotoxins. Food Control, 2011; (22), 462–8. doi: 10.1016/j.foodcont.2010.09.028.

5.   Gagkaeva TYu, Gavrilova OP, Orina AS, Blinova EV, Loskutov IG. Response of wild Avena species to fungal infection of grain. The Crop Journal, 2017; 5(6), 499–508. doi: 10.1016/j.cj.2017.04.005.

6.   Орина АС, Гаврилова ОП, Гагкаева ТЮ. Колонизация культурных и дикорастущих злаковых растений грибами родов Alternaria, Cladosporium и Fusarium. Защита и карантин растений, 2017; (6), 25–7.

7.   Ellis MB. Dematiaceos hyphomycetes. Kew: Commonwealth Mycological Institute; 1971.

8.   Yli-Mattila T, Paavanen-Huhtala S, Parikka P, Konstantinova P, Gagkaeva TY. Molecular and morphological diversity of Fusarium fungi in Finland and north-western Russia. Eur J Plant Pathology, 2004; 110, 573–85. doi: 10.1023/B:EJPP.0000032397.65710.69.

9.   Pavón MÁ, González I, Martín R, García Lacarra T. ITS-based detection and quantification of Alternaria spp. in raw and processed vegetables by real-time quantitative PCR. Food Microbiol; 2012; 32(1), 165–71. doi: 10.1016/j.fm.2012.05.006.

10.   Matusinsky P, Frei P, Mikolasova R, Svacinovaa I, Tvaruzeka L, Spitzera T. Species-specific detection of Bipolaris sorokiniana from wheat and barley tissues. Crop Protection, 2010; 29, 1325–30. doi: 10.1016/j.cropro.2010.07.013.

11.   СанПиН 2.3.2.1078-01 «Гигиенические требования безопасности и пищевой ценности пищевых продуктов»; 2002.

12.   Hofgaard IS, Aamot HU, Torp T, Jestoi M, Lattanzio VMT, Klemsdal SS, Waalwijk C, van der Lee T, Brodal G. Associations between Fusarium species and mycotoxins in oats and spring wheat from farmers’ fields in Norway over a six-year period. World Mycotoxin J, 2016; 9(3), 365–78. doi: 10.3920/WMJ2015.2003.

13.   Desjardins AE. Fusarium Mycotoxins. Chemistry, Genetics, and Biology. St. Paul: American Phytopathological Society; 2006. doi: 10.1111/j.1365-3059.2006.01505.x.

14.   Орина AC, Гаврилова ОП, Гагкаева ТЮ, Лоскутов ИГ. Симбиотические взаимоотношения грибов рода Fusarium и Alternaria, колонизирующих зерно овса. Сельскохозяйственная биология, 2017; 52(5), 986–94. doi: 10.15389/agrobiology.2017.5.986rus.

Рис. 1. Содержание ДНК Alternaria в образцах зерна овса, ячменя и пшеницы. Данные представлены как среднее значение показателя с ошибкой среднего (M±SEM) и доверительным интервалом при уровне значимости 0.05.
Рис. 2. Содержание ДНК B. sorokiniana в образцах зерна овса, ячменя и пшеницы. Данные представлены как среднее значение показателя с ошибкой среднего (M±SEM) и доверительным интервалом при уровне значимости 0.05.