ISSN 2500-2236
DOI-prefix: 10.18527/2500-2236
ИССЛЕДОВАТЕЛЬСКАЯ СТАТЬЯ

Разработка холодоадаптированного реассортантного вируса гриппа А/H6N1 на основе донора аттенуации A/Ленинград/134/17/57 (H2N2) и его генотипирование методом анализа кривых плавления высокого разрешения (HRM-анализ)

Аннотация


Холодоадаптированный реассортантный штамм вируса гриппа А/17/серебристая чайка/Сарма/2006/887 (H6N1) получен на основе донора аттенуации А/Ленинград/134/17/57 (H2N2) методом генетической реассортации в куриных эмбрионах. Структура генома реассортанта была проанализирована методом ПЦР в реальном времени с последующим анализом кривых плавления высокого разрешения (high resolution melting, HRM-анализ) при использовании интеркалирующего флуоресцентного красителя EvaGreen. Анализ кривых плавления ДНК копий РНК фрагментов (PB2, PB1, PA, NP, М, NS) показал, что реассортантный вирус гриппа А/17/серебристая чайка/Сарма/2006/887 (H6N1) унаследовал гены внутренних и неструктурных белков от донора аттенуации. По антигенным свойствам реассортант соответствовал вирусу гриппа птиц А/серебристая чайка/Сарма/51с/2006 (H6N1). Изучение фенотипических свойств реассортанта показало, что вирус А/17/серебристая чайка/Сарма/2006/887 (H6N1) характеризуется температурочувствительностью и холодоадаптированностью в куриных эмбрионах и аттенуирован для мышей при интраназальном введении. Данный реассортант может быть рекомендован кандидатом в вакцинные штаммы для живой гриппозной вакцины для людей.

Abstract


The cold-adapted reassortant influenza virus А/17/herring gull/Sarma/2006/887 (H6N1) was developed in chicken embryos by genetic reassortment based on the A/Leningrad/134/17/57 (H2N2) master donor virus. The genome composition of the obtained reassortant was analyzed by means of real time PCR with the high resolution melting (HRM-analysis) using an intercalating fluorescent dye EvaGreen. Analysis of the DNA copies melting curves of RNA gene fragments (PB2, PB1, PA, NP, M, NS) showed that the reassortant influenza virus А/17/herring gull/2006/887(H6N1) contained the internal proteins coding genes from the master donor virus and the surface antigens coding genes from the A/herring gull/Sarma/51c/2006 (H6N1) avian influenza virus. The study of phenotypic properties showed that the А/17/herring gull/Sarma/2006/887 (H6N1) is temperature sensitive (ts) and cold-adapted (ca) in chicken embryos and attenuated in mice when administered intranasally. This reassortant can be recommended as a live influenza vaccine candidate for humans.

Введение


Вирус гриппа подтипа H6N1, который активно выделяется в последнее время от диких и домашних птиц, относится к семейству Orthomyxoviridae и роду Influenzavirus А. До настоящего времени не было отмечено тяжелых случаев инфицирования человека вирусами данного подтипа. Однако серологические наблюдения, проводимые в Южном Китае, выявили наличие антител к вирусам гриппа подтипа H6 у 13% жителей различных провинций [1]. Филогенетический анализ вирусов гриппа А свидетельствует, что близкородственные гены, кодирующие внутренние белки, встречаются у вирусов гриппа А различных подтипов и между вирусами гриппа птиц и человека возможна реассортация [2]. Также установлено, что некоторые из сегментов генов NP и NA высокопатогенных вирусов H5N1 происходят от вируса H6 диких уток [3, 4]. Таким образом, вирус гриппа птиц подтипа H6N1 является потенциально опасным для людей, что вызывает необходимость разработки соответствующего вакцинного штамма для защиты людей от возможной инфекции. Один из вакцинных кандидатов для живой гриппозной вакцины (ЖГВ) – вирус A/чирок/Гонконг/97/AA (H6N1) – был получен на основе донора аттенуации А/Энн Арбор/6/60 (H2N2) (Flumist®, США) с использованием вируса гриппа птиц подтипа H6N1, выделенного в 1997 году [5]. Однако данный вакцинный вирус очень слабо репродуцировался в респираторном тракте вакцинируемых и проявил низкую иммуногенную активность. Современные живые гриппозные вакцины представляют собой аттенуированные реассортантные штаммы с формулой генома 6:2. Гены, кодирующие гемагглютинин (HA) и нейраминидазу (NA), наследуются от антигенно актуального штамма, а шесть генов, кодирующих негликозилированные белки, – от холодоадаптированного (ХА) донора аттенуации.

Ранее нами уже были получены и изучены вакцинные штаммы, содержащие поверхностные антигены апатогенных вирусов гриппа птиц подтипов А(H5N2), А(H7N3) и А(H9N2), на основе холодоадаптированного донора аттенуации А/Ленинград/134/17/57(H2N2) (Лен/17), который лицензирован в Российской Федерации для подготовки вакцинных штаммов ЖГВ для иммунизации взрослых и детей от 3-х лет [6-9]. Вакцинные штаммы сероподтипов H5N2 и H7N3 были проверены в клинических исследованиях и показали высокую иммуногенную активность, вызывая сероконверсии у 54.8% и 72% привитых после двукратной иммунизации, соответственно. Цель настоящего исследования состояла в получении вакцинного кандидата подтипа H6N1 на основе донора Лен/17, содержащего поверхностные антигены вируса А/серебристая чайка/Сарма/51с/2006 (H6N1), и в изучении его свойств in vitro и на лабораторных животных.

Традиционно анализ состава генома кандидатов в вакцинные штаммы, полученных методами классической генетической реассортации, осуществляется методом полимеразной цепной реакции с обратной транскрипцией (ОТ-ПЦР) и последующим рестрикционным анализом продуктов амплификации [10] или мультиплексной ПЦР [11] и последующим полным секвенированием всех генов реассортанта. Для быстрого анализа состава генома потенциальных вакцинных кандидатов применяют также ПЦР в реальном времени с использованием гидролизируемых олигонуклеотидных зондов [12] и пиросеквенирования [13]. Для упрощения процедуры скрининга вакцинных кандидатов мы предлагаем использовать ПЦР в режиме реального времени с анализом кривых плавления высокого разрешения (HRM-анализ). Данный метод позволяет экономить время по сравнению с визуализацией результатов в агарозном геле при ПЦР-анализе и снижает риск контаминации ампликонами. Кроме того, данный метод является сравнительно недорогим, так как не требует использования дорогостоящих флуоресцентных олигонуклеотидных зондов.

Материалы и методы


Вирусы

В работе были использованы следующие вирусы гриппа: донор аттенуации Лен/17 и пандемический вирус дикого типа (дт) А/Ленинград/134/57(H2N2) (Лен/дт), полученные из коллекции отдела вирусологии ФГБНУ «Институт экспериментальной медицины», а также вирус гриппа птиц А/cеребристая чайка/Сарма/51с/2006 (H6N1) (H6N1/дт), предоставленный ФГБУ «НИИ гриппа».

Вирусы культивировали в развивающихся 10-дневных куриных эмбрионах (птицефабрика «Скворицы», Ленинградская область). Инфекционную активность вирусов определяли в развивающихся куриных эмбрионах при оптимальной (33°С), повышенной (до 39ºС) и пониженной (до 26ºС) температуре, 50%-ную эмбриональную инфекционную дозу (ЭИД50) рассчитывали по методу Reed – Muench [14].

ОТ-ПЦР в реальном времени с HRM-анализом

Для генотипирования вирусную РНК выделяли из 80 мкл вирусосодержащей аллантоисной жидкости с помощью набора QIAamp Viral RNA Mini Kit (Qiagen, Нидерланды). Полученные образцы РНК хранились при температуре -20°С. ОТ проводили с использованием ревертазы мышиного вируса лейкемии Молони (M-MulV Reverse Transcriptase, Сиб­Энзим) и случайных гексамеров. ПЦР в реальном времени проводили с использованием термоциклера CFX96 (Bio-Rad, США) с праймерами, разработанными для генов внутренних и неструктурных белков донора аттенуации Лен/17 [10]. Дополнительно для генов РВ1 и РА с помощью программы Primer3 [15] были разработаны следующие пары праймеров: PB1-F781 (5’ TACTTTGTCGAAACACTAGCGA 3’), PB1-R952 (5’ TCCATTTGGTATTGTCTCCAG 3’); PA-F47 (5’ GCTTCAATCCGATGATTGTCGAGC 3’), PA-R206 (5’ ATTGACTCGCCTTGCTCATT 3’). Реакцию проводили в объеме 20 мкл, содержащем 10 мкл реакционной смеси SsoFast™ EvaGreen® Supermix (Bio-Rad, США), 0.5 мкM каждого праймера, 4 мкл кДНК и воды, свободной от РНКаз, согласно рекомендациям производителя. Плавление продуктов ПЦР осуществляли при температуре от 65°С до 95°С с инкрементом в 0.5°С. HRM-анализ кривых плавления проводили с использованием компьютерного программного обеспечения Precision Melt Analysis Software, Version 1.1 (Bio-Rad, США).

Секвенирование по Сэнгеру

Для частичного секвенирования были получены ДНК-копии сегментов РНК PB2, PB1, PA, NP и NA с помощью набора OneStep RT-PCR Kit (Qiagen, Нидерланды). После электрофореза в 1.5% агарозном геле ДНК-копий и очистки посредством QIAquick PCR purification Kit (Qiagen, Нидерланды) секвенирование было выполнено с помощью набора реактивов BigDye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems, США) на ДНК-анализаторе ABI 3730xl. Обработку электрофореграмм нуклеотидных последовательностей проводили с помощью пакета программ 3730 Data Collection v3.0 software (Applied Biosystems, США). Частичные нуклеотидные последовательности генов РВ2, РВ1 и NP депонированы в базе данных GISAID EpiFlu под номерами PB2 EPI774106, PB1 EPI774107 и NP EPI774105.

Определение принадлежности генов, кодирующих поверхностные антигены

Происхождение НА было подтверждено в реакции торможения гемагглютинации (РТГА) со специфической крысиной антисывороткой. Происхождение гена NA реассортанта было определено в одноступенчатой ОТ-ПЦР с праймерами NA-F101 (5’ GATTAGCTCAACCCAGAAAC 3’) и NA-R605 (5’AGAAAAAGGAAAAGTAGTAAATCA 3’) с последующим секвенированием полученного фрагмента.

Изучение прививочных свойств реассортантного вируса на мышах

Мышей линии CBA в возрасте 10 недель (Рапполово, Ленинградская область) под легким эфирным наркозом заражали интраназально 50 мкл вируссодержащей аллантоисной жидкости с содержанием вируса 106 ЭИД50. В качестве препарата плацебо использовали стерильный фосфатно-солевой буфер. Эвтаназию проводили согласно «Правилам проведения работ с использованием экспериментальных животных». Концентрацию вирусов определяли в легких и в носовых ходах мышей на третьи сутки по показателям титрования суспензии органов в развивающихся куриных эмбрионах, начиная с разведения 1:10 для легких и 1:2 для носовых ходов. Через 3 недели после иммунизации собирали образцы крови. Сыворотки обрабатывали нейраминидазой Vibrio cholerae (Denka-Seiken, Япония) и тестировали на присутствие антигемагглютинирующих антител к вакцинному вирусу Лен17/Н6, как описано в [16].

Статистический анализ

Обработка результатов исследования проводилась с помощью статистического пакета «Statistica» (версия 6.0). Для представления полученных данных использовали показатели описательной статистики: среднее арифметическое, среднегеометрические титры (СГТ), среднеквадратичное отклонение. Сравнение двух независимых групп проводили с помощью непараметрического критерия Манна-Уитни. Различия считались статистически значимыми при р <0.05.

Результаты и Обсуждение


Реассортантный кандидат в вакцинные штаммы был получен методом классической генетической реассортации вируса гриппа птиц H6N1/дт и ХА донора аттенуации Лен/17, как описано в [17], и назван Лен17/Н6. В РТГА со специфической крысиной антисывороткой было подтверждено происхождение гена НА реассортанта Лен17/Н6 от вируса гриппа птиц H6N1/дт. Путем секвенирования фрагмента гена NA было показано, что ген NA реассортанта также происходит от вируса H6N1/дт.

Происхождение остальных генов реассортанта определяли методом ПЦР в реальном времени с последующим HRM-анализом с применением интеркалирующего флуоресцентного красителя EvaGreen. ПЦР в реальном времени с использованием неспе­цифических ДНК-связывающих красителей обычно включает анализ кривых плавления продуктов ПЦР. Для этого температура в пробах постепенно увеличивается, что приводит к высвобождению флуорофора из денатурированной двухцепочечной ДНК. Скорость изменения флуоресценции позволяет выявить пик, который соответствует температуре плавления комплексов двухцепочечной ДНК. Праймеры-димеры обычно плавятся при более низкой температуре благодаря их меньшему размеру, что дает возможность дискриминации амплифицированного фрагмента ПЦР от праймеров-димеров и других неспе­цифических продуктов.

Анализ кривых плавления высокого разрешения, предложенный в [18], позволяет генерировать профили кривых плавления, которые достаточно специфичны и чувствительны для разделения нуклеиновых кислот на основании незначительных различий в них, что делает возможным сканирование мутаций, анализ метилирования и генотипирование [19]. HRM-анализ может использоваться для характеристики образцов на основании их CG-состава и комплементарности последовательностей ДНК. Возрастающий интерес к упрощению анализа однонуклеотидных полиморфизмов приводит к активному развитию HRM-технологии. Для проведения анализа кривых плавления высокого разрешения рекомендуют использовать интеркалирующие красители третьего поколения, такие как EvaGreen, LCGreen и SYTO9 [20]. Эти красители малотоксичны, не вызывают ингибирования течения ПЦР и могут использоваться в ПЦР в реальном времени в более высоких концентрациях по сравнению с SybrGreen, что позволяет достичь более полного насыщения ими двухцепочечной ДНК и уменьшить динамическое перераспределение красителя в неденатурированные области ДНК при ее плавлении. HRM-анализ начинает вводиться в практику при изучении вирусов гриппа, например, для детекции и количественного анализа вируса [21], а также для скрининга появляющихся в популяции новых штаммов [22].

На Рис. 1 представлены результаты HRM-анали­за генов внутренних и неструктурных белков реассортантного штамма Лен17/H6. Показано, что программа Precision Melt Analysis автоматически проводит кластеризацию для всех позитивных лунок. Для облегчения визуальной идентификации кластеров программа генерирует так называемые «кривые различия» для каждой лунки, которые показывают отличия флуоресценции в лунке от референсной кривой. Последняя определяется как средняя по всем кривым флуоресценции для выбранного кластера сравнения. На графике хорошо видно, что вирус H6N1/дт отличается от донора аттенуации Лен/17 по форме кривых плавления и температурному профилю, на основании чего можно сделать вывод, что гены внутренних и неструктурных белков реассортанта Лен17/H6 унаследованы от ХА донора аттенуации Лен/17.

Верификацию полученных данных проводили при помощи классического метода ОТ-ПЦР с последующим рестрикционным анализом, как описано в [10]. На Рис. 2 видно, что ДНК-фрагменты генов PB2, NP, M и NS донорского штамма и вакцинного кандидата разрезаются рестриктазами на фрагменты, что соответствует наличию в них нуклеотидных замещений, характерных для донора аттенуации (PB2 и NS), или вирусов подтипа H2N2 (NP и M), в то время как амплификаты вируса гриппа птиц не режутся. Полученные результаты подтверждают данные HRM-анализа и свидетельствуют, что процесс плавления продуктов ПЦР не нарушает структуры дуплекса, что делает возможным дополнительный анализ амплификатов другими методами. В то же время на Рис. 2 видно отсутствие амплификации фрагментов РВ1 и РА вируса H6N1/дт с праймерами, специфичными для генов донора аттенуации Лен/17, вследствие выраженных различий между вирусами подтипов H2N2 и H6N1. В связи с этим для генов РВ1 и РА были разработаны новые праймеры с целью амплификации более коротких участков (781-952 и 47-206, соответственно). Амплификация фрагментов генов РВ1 и РА вируса H6N1/дт с новыми праймерами прошла успешно, что было подтверждено секвенированием полученных фрагментов. Рис. 3 показывает, что при HRM-анализе, выполненном с помощью программы Precision Melt Analysis, имеется отчетливое различие кривых плавления для фрагментов генов донора аттенуации Лен/17 и Лен/дт, отличающихся всего на одну нуклеотидную замену.

Таким образом подтверждено, что реассортант Лен17/Н6 приобрел 6 генов, кодирующих внутренние и неструктурные белки от донора Лен/17. Поиск гомологичных последовательностей в GenBank, проведенный с помощью компьютерной программы BLAST [23], показал, что ген РВ1 вируса H6N1/дт наиболее близок гену вируса гриппа птиц A/утка/Цзянси/5945/2008 (H6N1) (GenBank, KP287703.1), а ген PА – гену вируса A/утка/Гуйчжоу /2492/2007 (H6N1) (GenBank, CY109657.1) (99% гомологии). Сравнение последовательностей гена PB1 донора аттенуации Лен/17, реассортанта Лен17/H6 и вируса дикого типа H6N1/дт показало, что как донор аттенуации, так и реассортант отличаются от вируса дикого типа по положению 819 (Т вместо А), которое находится в специфическом сайте расщепления и позволяет различить данные гены с помощью традиционного рестрикционного анализа (Рис. 3). В то же время в гене РА в положении 107 присутствует нуклеотид С не только у реассортанта и донора аттенуации, но и у вируса H6N1/дт, а также у вируса гриппа птиц A/утка/Гуйчжоу/2492/2007 (H6N1). Поскольку указанный нуклеотид также входит в специфический сайт расщепления, то в данном случае определить происхождение генов с помощью традиционного рестрикционного анализа становится невозможным. Данные результаты подтверждают ограниченные возможности используемого рестрикционного анализа при генотипировании вакцинных штаммов вирусов гриппа птиц и свидетельствуют о необходимости применения новых методов скрининга вакцинных кандидатов.

При изучении репродукции вакцинного кандидата Лен17/H6 в куриных эмбрионах при различной температуре было показано, что данный вирус, так же как и донорский штамм Лен/17, проявляет свойства температурочувствительности и ХА, в отличие от штамма H6N1/дт. Разница титров вакцинного кандидата при оптимальной (33˚С) и повышенной (39˚С) температуре составила 7.0 log10ЭИД50/мл, отличие в показателях репродукции при пониженной и оптимальной температуре не превышало 3.0 log10 ЭИД50/мл (Табл. 1).

Вирус

Характеристика препарата

Репродукция в куриных эмбрионах, log10 ЭИД50/мл

Репродукция в дыхательных путях мышей на третьи сутки, log10 ЭИД50/мл, n=4

СГТ антител, n=7

26˚С

33˚С

39˚С

легкие

носовые ходы

Лен17/Н6

Вакцинный кандидат

6.5±0.8

9.3±0.3

2.3±0.3

2.8±0.8

3.3±0.5

17.4

Лен/17

Донор аттенуации

7.9±0.7

9.3±0.5

2.2±0.6

2.3±0.7

2.5±0.9

≤10

Н6N1/дт

Вирус дикого типа

1.5±0.0

6.7±0.1

7.2±0.4

4.1±0.3

2.8±0.9

16.8

Таблица 1. Биологические свойства реассортантного вакцинного кандидата Лен17/Н6 в сравнении с родительскими вирусами.

СГТ – среднегеометрический титр антител, n- число животных в группе

 

При интраназальном введении мышам в дозе 106 ЭИД50 титр вируса Лен17/H6 в легких животных был на 1.3 log10ЭИД50/мл меньше по сравнению с родительским вирусом H6N1/дт, что соответствовало уровню репродукции в легких мышей ХА донорского штамма (Табл. 1). В то же время вакцинный штамм Лен17/H6 хорошо репродуцировался в носовых ходах мышей, где температура существенно ниже, и вызывал системный иммунный ответ, определяемый по уровню антигемагглютинирующих антител в сыворотках крови с СГТ 17.4 через 3 недели после однократного введения. Следует отметить, что среди других вакцинных кандидатов на основе апатогенных вирусов гриппа птиц штамм Лен17/Н6 характеризуется наиболее высокой иммуногенностью у мышей после однократного введения. Так, при изучении на мышах вирусов других потенциально пандемических подтипов иммуногенность была существенно ниже после однократной иммунизации вакцинными кандидатами Н5N2 (СГТ=6.6; p=0.047), Н7N3 (СГТ=8.7; p=0.047) и H9N2 (СГТ=5.0; p=0.0009) по сравнению с Лен 17/Н6.

Таким образом, в настоящем исследовании показано, что методом HRM-анализа можно определять олигонуклеотидные и однонуклеотидные различия в генах вируса гриппа, что позволяет применять этот метод для скрининга вакцинных кандидатов. Состав генома вакцинного штамма Лен17/H6, выявленный с помощью HRM-анализа, подтвержден методом рестрикционного анализа и частичным секвенированием. По фенотипическим свойствам in vitro (температурочувствительность и ХА) и in vivo (аттенуация для мышей и иммунный ответ при однократном интраназальном введении) вакцинный кандидат соответствует донору аттенуации Лен/17 и, следовательно, удовлетворяет требованиям, предъявляемым к вакцинным кандидатам ЖГВ.

Благодарности


Авторы выражают благодарность сотруднику Иркутского государственного университета д-ру Александру Ляпунову, который выделил образец вируса гриппа птиц А/серебристая чайка/Сарма/51с/2006 (H6N1) от серебристой чайки и предоставил его сотрудникам ФГБУ «НИИ гриппа» Минздрава России.

Работа поддержана грантом Правительства Санкт-Петербурга в сфере научной и научно-технической деятельности № 198 от 14.10.2015 г.

Конфликт интересов


Авторы подтверждают отсутствие конфликта интересов.

Цитирование


Дешева ЮА, Смолоногина ТА, Ландграф ГО, Руденко ЛГ. Разработка холодоадаптированного реассортантного вируса гриппа А/H6N1 на основе донора аттенуации A/Ленинград/134/17/57 (H2N2) и его генотипирование методом анализа кривых плавления высокого разрешения (HRM-анализ). MIR J, 2016; 3(1), 42-48, doi: 10.18527/2500-2236-2016-3-1-42-48.


© 2016 Дешева и др. Эта статья публикуется в свободном доступе в соответствии с лицензией Creative Commons AttributionNonCommercial-ShareAlike 4.0 International Public License (CC BY-NC-SA), которая позволяет неограниченное использование, распространение и воспроизведение на любых носителях при условии, что указываются автор и источник публикации, а материал не используется в коммерческих целях.

Литература


1.            Wei SH, Yang JR, Wu HS, Chang MC, Lin JS, Lin CY, Liu YL, Lo YC, Yang CH, Chuang JH, Lin MC, Chung WC, Liao CH, Lee MS, Huang WT, Chen PJ, Liu MT, Chang FY. Human infection with avian influenza A H6N1 virus: an epidemiological analysis. Lancet Respir Med 2013; 1(10), 771-8.

2.            Zhou NN, Senne DA, Landgraf JS, Swenson SL, Erickson G, Rossow K, Liu L, Yoon Kj, Krauss S, Webster RG. Genetic reassortment of avian, swine, and human influenza A viruses in American pigs. J Virol 1999; 73(10), 8851-6.

3.            Huang K, Bahl J, Fan XH, Vijaykrishna D, Cheung CL, Webby RJ, Webster RG, Chen H, Smith GJ, Peiris JS, Guan Y. Establishment of an H6N2 influenza virus lineage in domestic ducks in southern China. J Virol 2010; 84(14), 6978-86.

4.            Hoffmann E, Stech J, Leneva I, Krauss S, Scholtissek C, San Chin P, Peiris M, Shortridge KF, Webster RG. Characterization of the influenza A virus gene pool in avian species in southern China: was H6N1 a derivative or a precursor of H5N1? J Virol 2000; 74(14), 6309-15.

5.            Talaat KR, Karron RA, Luke CJ, Thumar B, McMahon BA, Chen GL, Lamirande EW, Jin H, Coelingh KL, Kemble G, Subbarao K. An open label Phase I trial of a live attenuated H6N1 influenza virus vaccine in healthy adults. Vaccine 2011; 29(17), 3144-8.

6.            Rudenko L, Desheva J, Korovkin S, Mironov A, Rekstin A, Grigorieva E, Donina S, Gambaryan A, Katlinsky A. Safety and immunogenicity of live attenuated influenza reassortant H5 vaccine (phase I-II clinical trials). Influenza Other Respir Viruses 2008; 2(6), 203-9.

7.            Rudenko L, Kiseleva I, Naykhin AN, Erofeeva M, Stukova M, Donina S, Petukhova G, Pisareva M, Krivitskaya V, Grudinin M, Buzitskaya Z, Isakova-Sivak I, Kuznetsova S, Larionova N, Desheva J, Dubrovina I, Nikiforova A, Victor JC, Neuzil K, Flores J, Tsvetnitsky V, Kiselev O. Assessment of human immune responses to H7 avian influenza virus of pandemic potential: results from a placebo-controlled, randomized double-blind phase I study of live attenuated H7N3 influenza vaccine. PLoS One 2014; 9(2), e87962.

8.            Дешева ЮА, Смолоногина ТА, Руденко ЛГ. Доклиническое изучение реассортантного вакцинного штамма вируса гриппа А/17/перепел/Гонконг/97/84 (H9N2). Вопр. вирусол, 2015; 60(4), 40-4.

9.            Дешева ЮА, Данини ГВ, Григорьева ЕП, Донина СА, Киселева ИВ, Рекстин АР, Ермакова ЛА, Нацина ВК, Николаева ВМ, Лонская НИ, Епишина ГА, Жаворонков ВГ, Дриневский ВП, Ерофеева МК, Найхин AН, Руденко ЛГ. Изучение безвредности, генетической стабильности и иммуногенности живой гриппозной вакцины для взрослых при вакцинации детей до 3х лет. Вопр. вирусол. 2002; 47(4), 21-4 .

10.          Klimov AI, Cox NJ. PCR restriction analysis of genome composition and stability of cold-adapted reassortant live influenza vaccines. J Virol Methods 1995; 52, 41-9.

11.          Ha SH, Kim HA, Kim YH, Kim JS, Lee KH, Park SY, Park WJ, Seong BL. A multiplex RT-PCR method for screening of reassortant live influenza vaccine virus strains. J Virol Methods. 2006;134:154–163.

12.          Shcherbik S, Sergent SB, Davis WG, Shu B, Barnes J, Kiseleva I, Larionova N, Klimov A, Bousse T. Application of real time RT-PCR for the genetic homogeneity and stability tests of the seed candidates for live attenuated influenza vaccine production. J Virol Methods 2014; 195, 18-25.

13.          Shcherbik SV, Pearce NC, Levine ML, Klimov AI, Villanueva JM, Bousse TL. Rapid strategy for screening by pyrosequencing of influenza virus reassortants-candidates for live attenuated vaccines. PloS one 2014; 9(3), e92580.

14.          Reed LJ, Muench H. A simple method of estimating fifty per cent endpoints. Am J Epidemiol 1938; 27(3), 493-7.

15.          Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, Rozen SG. Primer3 - new capabilities and interfaces. Nucl Acid Res 2012; 40(15), e115

16.          Rowe T, Abernathy RA, Hu-Primmer J, Thompson WW, Lu X, Lim W, Fukuda K, Cox NJ, Katz JM. Detection of antibody to avian influenza A (H5N1) virus in human serum by using a combination of serologic assays. J clin microbiol. 1999; 37(4), 937-43.

17.          Александрова ГИ. Применение метода генетиче­ской рекомбинации для получения вакцинных штам­мов вируса гриппа. Вопр. вирусол. 1977; 4(4), 387–95.

18.          Wittwer CT, Reed GH, Gundry CN, Vandersteen JG, Pryor RJ High resolution genotyping by amplicon melting analysis using LCGreen, Clin Chem 2003; 49, 853-860.

19.          Liew M, Pryor R, Palais R, Meadows C, Erali M, Lyon E, Wittwer C. Genotyping of single-nucleotide polymorphisms by high-resolution melting of small amplicons. Clin chem 2004; 50(7), 1156-64.

20.          Eischeid AC. SYTO dyes and EvaGreen outperform SYBR Green in real-time PCR. BMC research notes 2011; 4(1), 263.

21.          Curd E, Pollinger J, Toffelmier E, Smith T. Rapid influenza A detection and quantitation in birds using a one-step real-time reverse transcriptase PCR and High Resolution Melting. J virol methods 2011; 176(1), 125-30.

22.          Lin JH, Tseng CP, Chen YJ, Lin CY, Chang SS, Wu HS, Cheng JC. Rapid differentiation of influenza A virus subtypes and genetic screening for virus variants by high-resolution melting analysis. J clin microbiol 2008; 46(3), 1090-7.

23.          Morgulis A, Coulouris G, Raytselis Y, Madden TL, Agarwala R, Schäffer AA. Database indexing for production MegaBLAST searches. Bioinform 2008; 24(16), 1757-64.

 

Рис. 1. HRM-анализ генов внутренних и неструктурных белков вакцинного кандидата Лен17/Н6 и родительских вирусов. Представлены суммарные данные двух экспериментов.
Рис. 2. Анализ генома вакцинного кандидата Лен17/Н6 методом ОТ-ПЦР с последующим рестрикционным анализом. Амплифицированные участки генов PB2 (1374-1614), NP (886-1200), M (39-249), NS (673-830), PB1 (740-1044) и PA (900-1077) вакцинного кандидата Лен17/Н6 и родительских вирусов обрабатывали эндонуклеазами рестрикции Tru 9I, Eco RI, Bst FNI и Cac8I соответственно и анализировали в агарозном геле. Участки генов PB1 (740-1044) и PA (900-1077) вакцинного кандидата Лен17/Н6 и родительских вирусов амплифицировали с помощью специфических праймеров и сравнивали в агарозном геле. M – ДНК маркер, N – отрицательный контроль; «-» – фрагменты, не обработанные рестриктазами, «+» – фрагменты, обработанные соответствующими рестриктазами.



Рис. 3. HRM-анализ генов PB1 и РА вакцинного кандидата Лен17/H6, родительских вирусов и пандемического вируса Лен/дт с подтверждением секвенированием амплифицированных фрагментов. Амплифицировали участки генов PB1 (781-952) и РА (886-1200) вакцинного кандидата Лен17/H6, родительских вирусов и пандемического вируса Лен/дт и сравнивали кривые плавления высокого разрешения. Амплифицированные участки также секвенировали, и сиквенс нуклеотидных последовательностей анализировали множественным выравниванием.